Purpose: The objective of this study was to design a multiplex PCR assay for the simultaneous detection of Salmonella, Shigella, Listeria monocytogenes and Verocytoxogenic Escherichia coli(VTEC) in fresh produce.
Methods: Two pre-enrichment media (TSB: tryptic soy broth and UPB: universal enrichment broth) were evaluated. A cocktail of 8 Salmonella, 7 Listeria monocytogenes, 4 Shigella and 2 VTEC strains, previously individually stressed on stainless steel chips (drying 2 h under laminar flowhood) was inoculated (10-100 cells each one) on carrots, lettuce, tomato, broccoli and jalapeño pepper and incubated at 35°C/18h in TSB and UPB. Pathogens quantification was performed along pre-enrichment in selective media for each pathogen supplemented with antibiotics (ASB+100 ppm of rifampicina, MOX+20 ppm of nalidixic acid, and XLD without antibiotics). Multiplex PCR was performed after 18h of pre-enrichment in both media and five produce. Volume of reaction was 20µl containing master mix (Quiagen) and specific primers for the following target genes: InvA (F:CGCGCTTGATGAGCTTTACC; R:CTCGTAATTCGCCGCCATTG), IpaH (F:CGCGCTCACATGGAACAATC; R: TCCCGACACGCCATAGAAAC), Hly (F:CTGCAAGTCCTAAGACGCCA; R: CTTCACTGATTGCGCCGAAG, and Stx1 (F:GATCAGTCGTACGGGGATGC; R: ATTGTGCGTAATCCCACGGA).
Results: The maximum population (Log CFU/ml) in TSB and UPB, respectively, were: 6.68-7.76 and 6.39-7.64 for Shigella, 5.39-7.16 and 6.33-6.88 for Salmonella, 5.22-6.72 and 5.60-6.14 for Listeria monocytogenes and 7.52-8.16 and 7.02-8.28 for VTEC. The multiplex PCR assay was able to detect all pathogens after 18 h of pre-enrichment.
Significance: These results can potentially lead to more rapid and sensitive methods for foodborne pathogen detection in fresh produce.